Version 5 (Aril 24, 2011)
MEGA is an integrated tool for conducting automatic and manual sequence alignment, inferring phylogenetic trees, mining web-based databases, estimating rates of molecular evolution, and testing evolutionary hypotheses.
!Title and ends with a semicolon#mega !Title This is an example title;
!Description and ends with a semicolon#mega !Title This is an example title; !Description This is detailed information the data file;
command=keyword format)
-, + or ._, *, :, ( ), |, \, /
| Command | Setting | Remark | Example |
|---|---|---|---|
| DataType | DNA, RNA, nucleotide, protein | DataType=DNA | |
| NSeqs | integer | Number of sequences | NSeqs=85 |
| NTaxa | integer | Synonymous with NSeqs | NTaxa=85 |
| NSites | integer | Number of nucleotides | Nsites=4592 |
| Property | Exon, Intron, Coding, Noncoding, and End | Specifies whether a domain is protein coding. Exon and Coding are synonymous, as are Intron and Noncoding. End specifies that the domain with the given name ends at this point | Property=cyt_b |
| Indel | single character | dash (-) to identify insertion/deletions | Indel = - |
| Identical | single character | use period (.) to show identity with the first sequence | Identical = . |
| MatchChar | single character | Synonymous with the identical keyword | MatchChar = . |
| Missing | single character | use question mark (?) to indicate missing data | Missing = ? |
| CodeTable | A name | This instruction gives the name of the code table for the protein coding domains of the data | CodeTable = Standard |
| Command | Setting | Remark | Example |
|---|---|---|---|
| Domain | A name | defines a domain with the given name | Domain=first_exon |
| Gene | A name | defines a gene with the given name | Gene=cytb |
| Property | Exon, Intron, Coding, Noncoding, and End | specifies the protein-coding attribute for a domain | Property=cytb |
| CodonStart | A number | specifies the site where the next 1st-codon position will be found in a protein-coding domain | CodonStart=2 |
!Gene=FirstGene Domain=Exon1 Property=Coding;
#Human_{Mammal} ATGGTTTCTAGTCAGGTCACCATGATAGGTCTCAAT
#Mouse_{Mammal} ATGGTTTCTAGTCAGGTCACCATGATAGGTCCCAAT
#Chicken_{Aves} ATGGTTTCTAGTCAGCTCACCATGATAGGTCTCAAT
!Gene=SecondGene Domain=Intron Property=Noncoding;
#Human ATTCCCAGGGAATTCCCGGGGGGTTTAAGGCCCCTTTAAAGAAAGAT
#Mouse GTAGCGCGCGTCGTCAGAGCTCCCAAGGGTAGCAGTCACAGAAAGAT
#Chicken GTAAAAAAAAAAGTCAGAGCTCCCCCCAATATATATCACAGAAAGAT
!Gene=ThirdGene Domain=Exon2 Property=Coding;
#Human ATCTGCTCTCGAGTACTGATACAAATGACTTCTGCGTACAACTGA
#Mouse ATCTGATCTCGTGTGCTGGTACGAATGATTTCTGCGTTCAACTGA
#Chicken ATCTGCTCTCGAGTACTGCTACCAATGACTTCTGCGTACAACTGA
!Label +++__-+++-a-+++-L-+++-k-+++123+++-_-+++---+++;
| Command | Setting | Remark | Example |
|---|---|---|---|
| DataType | Distance | Specifies that the distance data is in the file | DataType=distance |
| NSeqs | integer | Number of sequences | NSeqs=85 |
| NTaxa | integer | Same as NSeqs | NTaxa=85 |
| DataFormat | Lowerleft, upperright | Specifies whether the data is in lower left triangular matrix or the upper right triangular matrix | DataFormat=lowerleft |
#mega
!Title: Concatenated Files;
!Format DataType=Distance DataFormat=LowerLeft NTaxa=6;
#Rodent
#Primate
#Lagomorpha
#Artiodactyla
#Carnivora
#Perissodactyla
0.514
0.535 0.436
0.530 0.388 0.418
0.521 0.353 0.417 0.345
0.500 0.331 0.402 0.327 0.349
Citation for MEGA 5:
Citation for MEGA 4: