migrate
Differences
This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
migrate [2011/07/12 10:50] – heidi | migrate [2011/07/14 15:02] (current) – heidi | ||
---|---|---|---|
Line 24: | Line 24: | ||
* Microsatellite | * Microsatellite | ||
* Standard (Electrophoretic marker) | * Standard (Electrophoretic marker) | ||
+ | |||
Line 81: | Line 82: | ||
.... | .... | ||
</ | </ | ||
- | * interleaved data (not anymore supported by MIGDRAT): < | + | * interleaved data (not anymore supported by MIGRATE): < |
<Number of populations> | <Number of populations> | ||
<number of sites for locus1> <number of sites for locus 2> ... | <number of sites for locus1> <number of sites for locus 2> ... | ||
Line 114: | Line 115: | ||
.... | .... | ||
</ | </ | ||
+ | |||
+ | |||
+ | |||
+ | |||
Line 126: | Line 131: | ||
* Genotypes | * Genotypes | ||
* missing data: "?" | * missing data: "?" | ||
- | * can use multi-character coding when you use a delimiter | + | * can use multi-character coding when you use a delimiter |
* 2 populations and 11 loci and with 3 or 2 individuals per population: < | * 2 populations and 11 loci and with 3 or 2 individuals per population: < | ||
2 11 Migration rates between two Turkish frog populations | 2 11 Migration rates between two Turkish frog populations | ||
Line 140: | Line 145: | ||
2 11 / Migration rates between two Turkish frog populations | 2 11 / Migration rates between two Turkish frog populations | ||
3 Akcapinar (between Marmaris and Adana) | 3 Akcapinar (between Marmaris and Adana) | ||
- | PB1058 e/e b/b a/b b/b b/b a/a a/a b/b ?/? c/c Rs/Rf | + | PB1058 |
- | PB1059 e/e b/b a/b b/b b/b a/a a/a b/b b/b c/c Rs/Rs | + | PB1059 |
- | 19 | + | PB1060 |
- | PB1060 e/e b/b b/? b/b a/b a/a a/a b/b b/b c/c Rs/Rs | + | |
2 Ezine (between Selcuk and Dardanelles) | 2 Ezine (between Selcuk and Dardanelles) | ||
- | PB16843 e/e b/b a/b b/b a/a a/a a/a c/c b/b c/c Rf/Rf | + | PB16843 |
- | PB16844 e/e b/b b/b b/b a/b a/a a/a c/c b/b c/c Rf/ | + | PB16844 |
Line 171: | Line 175: | ||
#M 2 2 2 | #M 2 2 2 | ||
2 Riedtli near Guendelhart-Hoerhausen | 2 Riedtli near Guendelhart-Hoerhausen | ||
- | 0 25.27 137.131 218.218 | + | 0 |
- | 0 27.27 218.216 | + | 0 |
2 Tal near Steckborn | 2 Tal near Steckborn | ||
- | 1 23.25 135.? 218.218 | + | 1 |
- | 1 23.23 135.131 220.218 | + | 1 |
</ | </ | ||
Line 210: | Line 214: | ||
50 | 50 | ||
3 Tallahassee (Mars) | 3 Tallahassee (Mars) | ||
- | Peter ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC | + | Peter |
- | Donald ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC | + | Donald |
Christian ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC | Christian ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC | ||
3 St. Marks | 3 St. Marks | ||
- | Lucrezia ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC | + | Lucrezia |
- | Isabel ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC | + | Isabel |
- | Yasmine ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC | + | Yasmine |
</ | </ | ||
* not interleaved (2 population with 2 loci): < | * not interleaved (2 population with 2 loci): < | ||
Line 269: | Line 273: | ||
1 4 | 1 4 | ||
3 3 pop1 | 3 3 pop1 | ||
- | ind1 A | + | ind1 A |
- | ind2 A | + | ind2 A |
- | ind3 A | + | ind3 A |
- | ind1 ACAC | + | ind1 ACAC |
- | ind2 ACAC | + | ind2 ACAC |
- | ind3 ACGC | + | ind3 ACGC |
2 pop2 | 2 pop2 | ||
- | ind4 C | + | ind4 C |
- | ind5 C | + | ind5 C |
- | ind4 TGGA | + | ind4 TGGA |
- | ind5 TCGA | + | ind5 TCGA |
</ | </ | ||
* '' | * '' | ||
Line 285: | Line 289: | ||
H 2 2 Make believe data set using simulated data (2 population and 2 loci) | H 2 2 Make believe data set using simulated data (2 population and 2 loci) | ||
3 pop1 | 3 pop1 | ||
- | 1 A 3 C 0 3 | + | 1 A 3 C 0 3 |
1000 A 3 T 0 3 | 1000 A 3 T 0 3 | ||
1010 C 3 G 0 3 | 1010 C 3 G 0 3 | ||
Line 291: | Line 295: | ||
1015 C 3 A 0 3 | 1015 C 3 A 0 3 | ||
2 pop2 | 2 pop2 | ||
- | 1 A 0 C 2 2 | + | 1 A 0 C 2 2 |
1000 A 0 T 2 2 | 1000 A 0 T 2 2 | ||
1010 C 1 G 1 2 | 1010 C 1 G 1 2 |
migrate.1310460627.txt.gz · Last modified: 2011/07/12 10:50 by heidi