migrate
Differences
This shows you the differences between two versions of the page.
| Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
| migrate [2011/07/12 10:45] – heidi | migrate [2011/07/14 15:02] (current) – heidi | ||
|---|---|---|---|
| Line 24: | Line 24: | ||
| * Microsatellite | * Microsatellite | ||
| * Standard (Electrophoretic marker) | * Standard (Electrophoretic marker) | ||
| + | |||
| Line 81: | Line 82: | ||
| .... | .... | ||
| </ | </ | ||
| - | * interleaved data (not anymore supported by MIGDRAT): < | + | * interleaved data (not anymore supported by MIGRATE): < |
| <Number of populations> | <Number of populations> | ||
| <number of sites for locus1> <number of sites for locus 2> ... | <number of sites for locus1> <number of sites for locus 2> ... | ||
| Line 114: | Line 115: | ||
| .... | .... | ||
| </ | </ | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| Line 125: | Line 131: | ||
| * Genotypes | * Genotypes | ||
| * missing data: "?" | * missing data: "?" | ||
| - | * can use multi-character coding when you use a delimiter | + | * can use multi-character coding when you use a delimiter |
| - | * 2 populations and 11 loci and with 3 or 2 individuals per population: | + | * 2 populations and 11 loci and with 3 or 2 individuals per population: < |
| - | < | + | |
| 2 11 Migration rates between two Turkish frog populations | 2 11 Migration rates between two Turkish frog populations | ||
| 3 Akcapinar (between Marmaris and Adana) | 3 Akcapinar (between Marmaris and Adana) | ||
| Line 137: | Line 142: | ||
| PB16844 | PB16844 | ||
| </ | </ | ||
| - | * same data but with ''/'' | + | * same data but with ''/'' |
| - | < | + | |
| 2 11 / Migration rates between two Turkish frog populations | 2 11 / Migration rates between two Turkish frog populations | ||
| 3 Akcapinar (between Marmaris and Adana) | 3 Akcapinar (between Marmaris and Adana) | ||
| - | PB1058 e/e b/b a/b b/b b/b a/a a/a b/b ?/? c/c Rs/Rf | + | PB1058 |
| - | PB1059 e/e b/b a/b b/b b/b a/a a/a b/b b/b c/c Rs/Rs | + | PB1059 |
| - | 19 | + | PB1060 |
| - | PB1060 e/e b/b b/? b/b a/b a/a a/a b/b b/b c/c Rs/Rs | + | |
| 2 Ezine (between Selcuk and Dardanelles) | 2 Ezine (between Selcuk and Dardanelles) | ||
| - | PB16843 e/e b/b a/b b/b a/a a/a a/a c/c b/b c/c Rf/Rf | + | PB16843 |
| - | PB16844 e/e b/b b/b b/b a/b a/a a/a c/c b/b c/c Rf/ | + | PB16844 |
| Line 156: | Line 159: | ||
| * homozygote individual: needs to be coded as e.g.: 6.6 (" | * homozygote individual: needs to be coded as e.g.: 6.6 (" | ||
| * missing data: "? | * missing data: "? | ||
| - | * Alleles are coded as REPEAT NUMBERS: | + | * Alleles are coded as REPEAT NUMBERS: < |
| - | < | + | |
| 2 3 . Rana lessonae: Seeruecken versus Tal | 2 3 . Rana lessonae: Seeruecken versus Tal | ||
| 2 | 2 | ||
| Line 169: | Line 171: | ||
| </ | </ | ||
| * Alleles encoded as FRAGMENT LENGTH: | * Alleles encoded as FRAGMENT LENGTH: | ||
| - | * extra line with repeat number, starts with ''# | + | * extra line with repeat number, starts with ''# |
| - | < | + | |
| 2 3 . Rana lessonae: Seeruecken versus Tal | 2 3 . Rana lessonae: Seeruecken versus Tal | ||
| #M 2 2 2 | #M 2 2 2 | ||
| 2 Riedtli near Guendelhart-Hoerhausen | 2 Riedtli near Guendelhart-Hoerhausen | ||
| - | 0 25.27 137.131 218.218 | + | 0 |
| - | 0 27.27 218.216 | + | 0 |
| 2 Tal near Steckborn | 2 Tal near Steckborn | ||
| - | 1 23.25 135.? 218.218 | + | 1 |
| - | 1 23.23 135.131 220.218 | + | 1 |
| </ | </ | ||
| Line 209: | Line 210: | ||
| **examples: | **examples: | ||
| - | * two populations with a single DNA-locus: | + | * two populations with a single DNA-locus: < |
| - | < | + | |
| 2 1 Make believe data set using simulated data (1 locus) | 2 1 Make believe data set using simulated data (1 locus) | ||
| 50 | 50 | ||
| 3 Tallahassee (Mars) | 3 Tallahassee (Mars) | ||
| - | Peter ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC | + | Peter |
| - | Donald ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC | + | Donald |
| Christian ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC | Christian ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC | ||
| 3 St. Marks | 3 St. Marks | ||
| - | Lucrezia ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC | + | Lucrezia |
| - | Isabel ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC | + | Isabel |
| - | Yasmine ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC | + | Yasmine |
| </ | </ | ||
| * not interleaved (2 population with 2 loci): < | * not interleaved (2 population with 2 loci): < | ||
| Line 263: | Line 263: | ||
| </ | </ | ||
| + | === SNP data === | ||
| + | * uses the same nucleotide nomenclature as the sequence data | ||
| + | * same format as sequence data | ||
| + | * linked SNP: more than one site on one line | ||
| + | * unlinked SNP: one site per line | ||
| + | * two formats: | ||
| + | * '' | ||
| + | N 2 2 Make believe data set using simulated data (2 population and 2 loci) | ||
| + | 1 4 | ||
| + | 3 3 pop1 | ||
| + | ind1 A | ||
| + | ind2 A | ||
| + | ind3 A | ||
| + | ind1 ACAC | ||
| + | ind2 ACAC | ||
| + | ind3 ACGC | ||
| + | 2 pop2 | ||
| + | ind4 C | ||
| + | ind5 C | ||
| + | ind4 TGGA | ||
| + | ind5 TCGA | ||
| + | </ | ||
| + | * '' | ||
| + | # using the HapMap data format, but does produce the same result (yet) as the dataset above | ||
| + | H 2 2 Make believe data set using simulated data (2 population and 2 loci) | ||
| + | 3 pop1 | ||
| + | 1 A 3 C 0 3 | ||
| + | 1000 A 3 T 0 3 | ||
| + | 1010 C 3 G 0 3 | ||
| + | 1011 A 2 G 1 3 | ||
| + | 1015 C 3 A 0 3 | ||
| + | 2 pop2 | ||
| + | 1 A 0 C 2 2 | ||
| + | 1000 A 0 T 2 2 | ||
| + | 1010 C 1 G 1 2 | ||
| + | 1011 A 0 G 2 2 | ||
| + | 1015 C 0 A 2 2 | ||
| + | </ | ||
| ===== How to cite ===== | ===== How to cite ===== | ||
| Beerli, P. (2009) How to use migrate or why are markov chain monte carlo programs dicult to use? In G. Bertorelle, M. W. Bruford, H. C. Haue, A. Rizzoli, and C. Vernesi, editors, Population Genetics for Animal Conservation, | Beerli, P. (2009) How to use migrate or why are markov chain monte carlo programs dicult to use? In G. Bertorelle, M. W. Bruford, H. C. Haue, A. Rizzoli, and C. Vernesi, editors, Population Genetics for Animal Conservation, | ||
migrate.1310460313.txt.gz · Last modified: 2011/07/12 10:45 by heidi