Masterarbeit, Heidi Lischer

User Tools

Site Tools

Trace:
migrate

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revisionPrevious revision
Next revision		Previous revision
migrate [2011/07/12 10:40] – heidimigrate [2011/07/14 15:02] (current) – heidi
Line 24: Line 24:
   * Microsatellite   * Microsatellite
   * Standard (Electrophoretic marker)   * Standard (Electrophoretic marker)
 +
  
  
Line 81: Line 82:
 .... ....
 </code> </code>
-  * interleaved data (not anymore supported by MIGDRAT): <code>+  * interleaved data (not anymore supported by MIGRATE): <code>
 <Number of populations> <number of loci> [project title 0-79] <Number of populations> <number of loci> [project title 0-79]
 <number of sites for locus1> <number of sites for locus 2> ... <number of sites for locus1> <number of sites for locus 2> ...
Line 114: Line 115:
 .... ....
 </code> </code>
 +
 +
 +
 +
 +
 +
 +
  
  
Line 123: Line 131:
   * Genotypes   * Genotypes
   * missing data: "?"   * missing data: "?"
-  * can use multi-character coding when you use a delimiter (see the examples for microsatellites) +  * can use multi-character coding when you use a delimiter 
-  * 2 populations and 11 loci and with 3 or 2 individuals per population: +  * 2 populations and 11 loci and with 3 or 2 individuals per population: <code>
-<code>+
  2 11 Migration rates between two Turkish frog populations  2 11 Migration rates between two Turkish frog populations
 3 Akcapinar (between Marmaris and Adana) 3 Akcapinar (between Marmaris and Adana)
Line 135: Line 142:
 PB16844   ee bb bb bb ab aa aa cc bb cc aa PB16844   ee bb bb bb ab aa aa cc bb cc aa
 </code> </code>
-  * same data but with ''/'' as separator: +  * same data but with ''/'' as separator: <code>
-<code>+
  2 11 / Migration rates between two Turkish frog populations  2 11 / Migration rates between two Turkish frog populations
 3 Akcapinar (between Marmaris and Adana) 3 Akcapinar (between Marmaris and Adana)
-PB1058 e/e b/b a/b b/b b/b a/a a/a b/b ?/? c/c Rs/Rf +PB1058    e/e b/b a/b b/b b/b a/a a/a b/b ?/? c/c Rs/Rf 
-PB1059 e/e b/b a/b b/b b/b a/a a/a b/b b/b c/c Rs/Rs +PB1059    e/e b/b a/b b/b b/b a/a a/a b/b b/b c/c Rs/Rs 
-19 +PB1060    e/e b/b b/? b/b a/b a/a a/a b/b b/b c/c Rs/Rs
-PB1060 e/e b/b b/? b/b a/b a/a a/a b/b b/b c/c Rs/Rs+
 2 Ezine (between Selcuk and Dardanelles) 2 Ezine (between Selcuk and Dardanelles)
-PB16843 e/e b/b a/b b/b a/a a/a a/a c/c b/b c/c Rf/Rf +PB16843   e/e b/b a/b b/b a/a a/a a/a c/c b/b c/c Rf/Rf 
-PB16844 e/e b/b b/b b/b a/b a/a a/a c/c b/b c/c Rf/Rs</code>+PB16844   e/e b/b b/b b/b a/b a/a a/a c/c b/b c/c Rf/Rs</code>
  
  
Line 154: Line 159:
   * homozygote individual: needs to be coded as e.g.: 6.6 ("." is the delimiter)   * homozygote individual: needs to be coded as e.g.: 6.6 ("." is the delimiter)
   * missing data: "?’"   * missing data: "?’"
-  * Alleles are coded as REPEAT NUMBERS: +  * Alleles are coded as REPEAT NUMBERS: <code>
-<code>+
  2 3 . Rana lessonae: Seeruecken versus Tal  2 3 . Rana lessonae: Seeruecken versus Tal
-2   Riedtli near G\"undelhart-H\"orhausen+2   Riedtli near Guendelhart-Hoerhausen
 0         42.45 37.31 18.18 0         42.45 37.31 18.18
 0         42.45 37.33 18.16 0         42.45 37.33 18.16
Line 167: Line 171:
 </code> </code>
   * Alleles encoded as FRAGMENT LENGTH:   * Alleles encoded as FRAGMENT LENGTH:
-    * extra line with repeat number, starts with ''#M'' +    * extra line with repeat number, starts with ''#M'' <code>
-<code>+
  2 3 . Rana lessonae: Seeruecken versus Tal  2 3 . Rana lessonae: Seeruecken versus Tal
 #M 2 2 2 #M 2 2 2
 2 Riedtli near Guendelhart-Hoerhausen 2 Riedtli near Guendelhart-Hoerhausen
-0 25.27 137.131 218.218 +0         25.27 137.131 218.218 
-0 27.27 218.216+0         27.27 218.216
 2 Tal near Steckborn 2 Tal near Steckborn
-1 23.25 135.? 218.218 +1         23.25 135.? 218.218 
-1 23.23 135.131 220.218+1         23.23 135.131 220.218
 </code>     </code>    
  
Line 207: Line 210:
  
 **examples:** **examples:**
 +  * two populations with a single DNA-locus: <code>
 +2 1 Make believe data set using simulated data (1 locus)
 +50
 +3 Tallahassee (Mars)
 +Peter     ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC
 +Donald    ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC
 +Christian ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC
 +3 St. Marks
 +Lucrezia  ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC
 +Isabel    ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC
 +Yasmine   ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC
 +</code>
   * not interleaved (2 population with 2 loci): <code>   * not interleaved (2 population with 2 loci): <code>
    2 2 Make believe data set using simulated data (2 loci)    2 2 Make believe data set using simulated data (2 loci)
Line 223: Line 238:
 fuefLoc2  TCGACTAGATATGCAGCAAATACGAGGGGCATGCGTCCCAGATGTG fuefLoc2  TCGACTAGATATGCAGCAAATACGAGGGGCATGCGTCCCAGATGTG
 </code> </code>
-  * interleaved (2 populations with 2 loci): <code>+  * interleaved (2 populations with 2 loci) (not anymore supported by MIGRATE): <code>
    2 2 Make believe data set using simulated data (2 loci, interleaved)    2 2 Make believe data set using simulated data (2 loci, interleaved)
 50 46 50 46
Line 248: Line 263:
 </code> </code>
  
 +=== SNP data ===
 +  * uses the same nucleotide nomenclature as the sequence data
 +  * same format as sequence data
 +  * linked SNP: more than one site on one line
 +  * unlinked SNP: one site per line
 +  * two formats:
 +    * ''N'': nucleotide format <code>
 +N 2 2 Make believe data set using simulated data (2 population and 2 loci)
 +1 4
 +3 3 pop1
 +ind1      A
 +ind2      A
 +ind3      A
 +ind1      ACAC
 +ind2      ACAC
 +ind3      ACGC
 +2 pop2
 +ind4      C
 +ind5      C
 +ind4      TGGA
 +ind5      TCGA
 +</code>
 +    * ''H'': HapMap format <code>
 +# using the HapMap data format, but does produce the same result (yet) as the dataset above
 +H 2 2 Make believe data set using simulated data (2 population and 2 loci)
 +3 pop1
 +1    A 3 C 0 3
 +1000 A 3 T 0 3
 +1010 C 3 G 0 3
 +1011 A 2 G 1 3
 +1015 C 3 A 0 3
 +2 pop2
 +1    A 0 C 2 2
 +1000 A 0 T 2 2
 +1010 C 1 G 1 2
 +1011 A 0 G 2 2
 +1015 C 0 A 2 2
 +</code>
  
 ===== How to cite ===== ===== How to cite =====
 Beerli, P. (2009) How to use migrate or why are markov chain monte carlo programs dicult to use? In G. Bertorelle, M. W. Bruford, H. C. Hau e, A. Rizzoli, and C. Vernesi, editors, Population Genetics for Animal Conservation, volume 17 of Conservation Biology, pages 42-79. Cambridge University Press, Cambridge UK, 2009. Beerli, P. (2009) How to use migrate or why are markov chain monte carlo programs dicult to use? In G. Bertorelle, M. W. Bruford, H. C. Hau e, A. Rizzoli, and C. Vernesi, editors, Population Genetics for Animal Conservation, volume 17 of Conservation Biology, pages 42-79. Cambridge University Press, Cambridge UK, 2009.
migrate.1310460043.txt.gz · Last modified: 2011/07/12 10:40 (external edit)