migrate
Differences
This shows you the differences between two versions of the page.
| Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
| migrate [2011/07/12 09:55] – heidi | migrate [2011/07/14 15:02] (current) – heidi | ||
|---|---|---|---|
| Line 24: | Line 24: | ||
| * Microsatellite | * Microsatellite | ||
| * Standard (Electrophoretic marker) | * Standard (Electrophoretic marker) | ||
| + | |||
| Line 81: | Line 82: | ||
| .... | .... | ||
| </ | </ | ||
| - | * interleaved data (not anymore supported by MIGDRAT): < | + | * interleaved data (not anymore supported by MIGRATE): < |
| <Number of populations> | <Number of populations> | ||
| <number of sites for locus1> <number of sites for locus 2> ... | <number of sites for locus1> <number of sites for locus 2> ... | ||
| Line 114: | Line 115: | ||
| .... | .... | ||
| </ | </ | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| ==== Examples ==== | ==== Examples ==== | ||
| Line 119: | Line 131: | ||
| * Genotypes | * Genotypes | ||
| * missing data: "?" | * missing data: "?" | ||
| - | * can use multi-character coding when you use a delimiter | + | * can use multi-character coding when you use a delimiter |
| - | **example** (2 populations and 11 loci and with 3 or 2 individuals per population: | + | * 2 populations and 11 loci and with 3 or 2 individuals per population: < |
| - | < | + | |
| 2 11 Migration rates between two Turkish frog populations | 2 11 Migration rates between two Turkish frog populations | ||
| 3 Akcapinar (between Marmaris and Adana) | 3 Akcapinar (between Marmaris and Adana) | ||
| Line 131: | Line 142: | ||
| PB16844 | PB16844 | ||
| </ | </ | ||
| + | * same data but with ''/'' | ||
| + | 2 11 / Migration rates between two Turkish frog populations | ||
| + | 3 Akcapinar (between Marmaris and Adana) | ||
| + | PB1058 | ||
| + | PB1059 | ||
| + | PB1060 | ||
| + | 2 Ezine (between Selcuk and Dardanelles) | ||
| + | PB16843 | ||
| + | PB16844 | ||
| + | |||
| === Microsatellite data === | === Microsatellite data === | ||
| Line 136: | Line 157: | ||
| * Genotypes | * Genotypes | ||
| * Each individual has two alleles | * Each individual has two alleles | ||
| - | * Alleles are coded as REPEAT NUMBERS | ||
| * homozygote individual: needs to be coded as e.g.: 6.6 (" | * homozygote individual: needs to be coded as e.g.: 6.6 (" | ||
| * missing data: "? | * missing data: "? | ||
| - | **example:** | + | |
| - | < | + | |
| 2 3 . Rana lessonae: Seeruecken versus Tal | 2 3 . Rana lessonae: Seeruecken versus Tal | ||
| - | 2 | + | 2 |
| 0 42.45 37.31 18.18 | 0 42.45 37.31 18.18 | ||
| 0 42.45 37.33 18.16 | 0 42.45 37.33 18.16 | ||
| Line 151: | Line 170: | ||
| 1 43.42 35.31 20.18 | 1 43.42 35.31 20.18 | ||
| </ | </ | ||
| + | * Alleles encoded as FRAGMENT LENGTH: | ||
| + | * extra line with repeat number, starts with ''# | ||
| + | 2 3 . Rana lessonae: Seeruecken versus Tal | ||
| + | #M 2 2 2 | ||
| + | 2 Riedtli near Guendelhart-Hoerhausen | ||
| + | 0 25.27 137.131 218.218 | ||
| + | 0 27.27 218.216 | ||
| + | 2 Tal near Steckborn | ||
| + | 1 23.25 135.? 218.218 | ||
| + | 1 23.23 135.131 220.218 | ||
| + | </ | ||
| === Sequence data === | === Sequence data === | ||
| Line 180: | Line 210: | ||
| **examples: | **examples: | ||
| + | * two populations with a single DNA-locus: < | ||
| + | 2 1 Make believe data set using simulated data (1 locus) | ||
| + | 50 | ||
| + | 3 Tallahassee (Mars) | ||
| + | Peter | ||
| + | Donald | ||
| + | Christian ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC | ||
| + | 3 St. Marks | ||
| + | Lucrezia | ||
| + | Isabel | ||
| + | Yasmine | ||
| + | </ | ||
| * not interleaved (2 population with 2 loci): < | * not interleaved (2 population with 2 loci): < | ||
| 2 2 Make believe data set using simulated data (2 loci) | 2 2 Make believe data set using simulated data (2 loci) | ||
| Line 196: | Line 238: | ||
| fuefLoc2 | fuefLoc2 | ||
| </ | </ | ||
| - | * interleaved (2 populations with 2 loci): < | + | * interleaved (2 populations with 2 loci) (not anymore supported by MIGRATE): < |
| 2 2 Make believe data set using simulated data (2 loci, interleaved) | 2 2 Make believe data set using simulated data (2 loci, interleaved) | ||
| 50 46 | 50 46 | ||
| Line 221: | Line 263: | ||
| </ | </ | ||
| + | === SNP data === | ||
| + | * uses the same nucleotide nomenclature as the sequence data | ||
| + | * same format as sequence data | ||
| + | * linked SNP: more than one site on one line | ||
| + | * unlinked SNP: one site per line | ||
| + | * two formats: | ||
| + | * '' | ||
| + | N 2 2 Make believe data set using simulated data (2 population and 2 loci) | ||
| + | 1 4 | ||
| + | 3 3 pop1 | ||
| + | ind1 A | ||
| + | ind2 A | ||
| + | ind3 A | ||
| + | ind1 ACAC | ||
| + | ind2 ACAC | ||
| + | ind3 ACGC | ||
| + | 2 pop2 | ||
| + | ind4 C | ||
| + | ind5 C | ||
| + | ind4 TGGA | ||
| + | ind5 TCGA | ||
| + | </ | ||
| + | * '' | ||
| + | # using the HapMap data format, but does produce the same result (yet) as the dataset above | ||
| + | H 2 2 Make believe data set using simulated data (2 population and 2 loci) | ||
| + | 3 pop1 | ||
| + | 1 A 3 C 0 3 | ||
| + | 1000 A 3 T 0 3 | ||
| + | 1010 C 3 G 0 3 | ||
| + | 1011 A 2 G 1 3 | ||
| + | 1015 C 3 A 0 3 | ||
| + | 2 pop2 | ||
| + | 1 A 0 C 2 2 | ||
| + | 1000 A 0 T 2 2 | ||
| + | 1010 C 1 G 1 2 | ||
| + | 1011 A 0 G 2 2 | ||
| + | 1015 C 0 A 2 2 | ||
| + | </ | ||
| ===== How to cite ===== | ===== How to cite ===== | ||
| Beerli, P. (2009) How to use migrate or why are markov chain monte carlo programs dicult to use? In G. Bertorelle, M. W. Bruford, H. C. Haue, A. Rizzoli, and C. Vernesi, editors, Population Genetics for Animal Conservation, | Beerli, P. (2009) How to use migrate or why are markov chain monte carlo programs dicult to use? In G. Bertorelle, M. W. Bruford, H. C. Haue, A. Rizzoli, and C. Vernesi, editors, Population Genetics for Animal Conservation, | ||
migrate.1310457351.txt.gz · Last modified: 2011/07/12 09:55 by heidi