Differences

This shows you the differences between two versions of the page.

--- migrate [2011/07/12 09:46] – heidi
+++ migrate [2011/07/14 15:02] (current) – heidi
@@ Line 24: / Line 24: @@
   * Microsatellite
   * Standard (Electrophoretic marker)
@@ Line 79: / Line 82: @@
 ....
 </code>
-  * interleaved data (not anymore supported by MIGDRAT): <code>
+  * interleaved data (not anymore supported by MIGRATE): <code>
 <Number of populations> <number of loci> [project title 0-79]
 <number of sites for locus1> <number of sites for locus 2> ...
@@ Line 97: / Line 100: @@
 </code>
+**SNPs in HapMap format**:
+  * assumes that each SNP is biallelic
+  * <allele> contains the nucleotide
+  * <number> contains the number of individuals with the specific allele
+  * <total> is the sum of both <code>
+<Number of populations> <number of loci> [project title 0-79]
+<Any Number> <title for population 0-79>
+<Position on chromosome locus1> <TAB><allele><TAB><number><TAB><allele><TAB><number><TAB><total>
+<Position on chromosome locus2> <TAB><allele><TAB><number><TAB><allele><TAB><number><TAB><total>
+....
+<Any Number> <title for population 0-79>
+<Position on chromosome locus1> <TAB><allele><TAB><number><TAB><allele><TAB><number><TAB><total>
+<Position on chromosome locus2> <TAB><allele><TAB><number><TAB><allele><TAB><number><TAB><total>
+....
+</code>
+==== Examples ====
 === Enzyme electrophoretic data (infinite allele model) ===
   * Genotypes
   * missing data: "?"
-  * can use multi-character coding when you use a delimiter (see the examples for microsatellites)
+  * can use multi-character coding when you use a delimiter
-**example** (2 populations and 11 loci and with 3 or 2 individuals per population:
+  * 2 populations and 11 loci and with 3 or 2 individuals per population: <code>
-<code>
 11 Migration rates between two Turkish frog populations
 Akcapinar (between Marmaris and Adana)
@@ Line 112: / Line 142: @@
 PB16844   ee bb bb bb ab aa aa cc bb cc aa
 </code>
+  * same data but with ''/'' as separator: <code>
+11 / Migration rates between two Turkish frog populations
+Akcapinar (between Marmaris and Adana)
+PB1058    e/e b/b a/b b/b b/b a/a a/a b/b ?/? c/c Rs/Rf
+PB1059    e/e b/b a/b b/b b/b a/a a/a b/b b/b c/c Rs/Rs
+PB1060    e/e b/b b/? b/b a/b a/a a/a b/b b/b c/c Rs/Rs
+Ezine (between Selcuk and Dardanelles)
+PB16843   e/e b/b a/b b/b a/a a/a a/a c/c b/b c/c Rf/Rf
+PB16844   e/e b/b b/b b/b a/b a/a a/a c/c b/b c/c Rf/Rs</code>
 === Microsatellite data ===
@@ Line 117: / Line 157: @@
   * Genotypes
   * Each individual has two alleles
-  * Alleles are coded as REPEAT NUMBERS
   * homozygote individual: needs to be coded as e.g.: 6.6 ("." is the delimiter)
   * missing data: "?’"
-**example:**
+  * Alleles are coded as REPEAT NUMBERS: <code>
-<code>
 3 . Rana lessonae: Seeruecken versus Tal
-   Riedtli near G\"undelhart-H\"orhausen
+   Riedtli near Guendelhart-Hoerhausen
          42.45 37.31 18.18
          42.45 37.33 18.16
@@ Line 132: / Line 170: @@
          43.42 35.31 20.18
 </code>
+  * Alleles encoded as FRAGMENT LENGTH:
+    * extra line with repeat number, starts with ''#M'' <code>
+3 . Rana lessonae: Seeruecken versus Tal
+#M 2 2 2
+Riedtli near Guendelhart-Hoerhausen
+         25.27 137.131 218.218
+         27.27 218.216
+Tal near Steckborn
+         23.25 135.? 218.218
+         23.23 135.131 220.218
+</code>
 === Sequence data ===
@@ Line 161: / Line 210: @@
 **examples:**
+  * two populations with a single DNA-locus: <code>
+1 Make believe data set using simulated data (1 locus)
+Tallahassee (Mars)
+Peter     ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC
+Donald    ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC
+Christian ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC
+St. Marks
+Lucrezia  ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC
+Isabel    ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC
+Yasmine   ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC
+</code>
   * not interleaved (2 population with 2 loci): <code>
 2 Make believe data set using simulated data (2 loci)
@@ Line 177: / Line 238: @@
 fuefLoc2  TCGACTAGATATGCAGCAAATACGAGGGGCATGCGTCCCAGATGTG
 </code>
-  * interleaved (2 populations with 2 loci): <code>
+  * interleaved (2 populations with 2 loci) (not anymore supported by MIGRATE): <code>
 2 Make believe data set using simulated data (2 loci, interleaved)
 46
@@ Line 202: / Line 263: @@
 </code>
+=== SNP data ===
+  * uses the same nucleotide nomenclature as the sequence data
+  * same format as sequence data
+  * linked SNP: more than one site on one line
+  * unlinked SNP: one site per line
+  * two formats:
+    * ''N'': nucleotide format <code>
+N 2 2 Make believe data set using simulated data (2 population and 2 loci)
+4
+3 pop1
+ind1      A
+ind2      A
+ind3      A
+ind1      ACAC
+ind2      ACAC
+ind3      ACGC
+pop2
+ind4      C
+ind5      C
+ind4      TGGA
+ind5      TCGA
+</code>
+    * ''H'': HapMap format <code>
+# using the HapMap data format, but does produce the same result (yet) as the dataset above
+H 2 2 Make believe data set using simulated data (2 population and 2 loci)
+pop1
+    A 3 C 0 3
+A 3 T 0 3
+C 3 G 0 3
+A 2 G 1 3
+C 3 A 0 3
+pop2
+    A 0 C 2 2
+A 0 T 2 2
+C 1 G 1 2
+A 0 G 2 2
+C 0 A 2 2
+</code>
 ===== How to cite =====
 Beerli, P. (2009) How to use migrate or why are markov chain monte carlo programs dicult to use? In G. Bertorelle, M. W. Bruford, H. C. Haue, A. Rizzoli, and C. Vernesi, editors, Population Genetics for Animal Conservation, volume 17 of Conservation Biology, pages 42-79. Cambridge University Press, Cambridge UK, 2009.