migrate
Differences
This shows you the differences between two versions of the page.
| Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
| migrate [2008/10/22 14:28] – heidi | migrate [2011/07/14 15:02] (current) – heidi | ||
|---|---|---|---|
| Line 3: | Line 3: | ||
| \\ | \\ | ||
| - | **[[http:// | + | **[[http:// |
| - | [[http:// | + | [[http:// |
| \\ | \\ | ||
| - | Version 3.0 (1. August 2008)\\ | + | Version 3.2.6 (13. October 2010)\\ |
| Migrate estimates population parameters, effective population sizes and migration rates of n populations, | Migrate estimates population parameters, effective population sizes and migration rates of n populations, | ||
| Line 24: | Line 24: | ||
| * Microsatellite | * Microsatellite | ||
| * Standard (Electrophoretic marker) | * Standard (Electrophoretic marker) | ||
| + | |||
| + | |||
| + | |||
| + | |||
| Line 78: | Line 82: | ||
| .... | .... | ||
| </ | </ | ||
| - | * interleaved data: < | + | * interleaved data (not anymore supported by MIGRATE): < |
| <Number of populations> | <Number of populations> | ||
| <number of sites for locus1> <number of sites for locus 2> ... | <number of sites for locus1> <number of sites for locus 2> ... | ||
| Line 96: | Line 100: | ||
| </ | </ | ||
| + | **SNPs in HapMap format**: | ||
| + | * assumes that each SNP is biallelic | ||
| + | * < | ||
| + | * < | ||
| + | * < | ||
| + | <Number of populations> | ||
| + | <Any Number> <title for population 0-79> | ||
| + | < | ||
| + | < | ||
| + | .... | ||
| + | <Any Number> <title for population 0-79> | ||
| + | < | ||
| + | < | ||
| + | .... | ||
| + | </ | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | ==== Examples ==== | ||
| === Enzyme electrophoretic data (infinite allele model) === | === Enzyme electrophoretic data (infinite allele model) === | ||
| * Genotypes | * Genotypes | ||
| * missing data: "?" | * missing data: "?" | ||
| - | * can use multi-character coding when you use a delimiter | + | * can use multi-character coding when you use a delimiter |
| - | **example** (2 populations and 11 loci and with 3 or 2 individuals per population: | + | * 2 populations and 11 loci and with 3 or 2 individuals per population: < |
| - | < | + | |
| 2 11 Migration rates between two Turkish frog populations | 2 11 Migration rates between two Turkish frog populations | ||
| 3 Akcapinar (between Marmaris and Adana) | 3 Akcapinar (between Marmaris and Adana) | ||
| Line 111: | Line 142: | ||
| PB16844 | PB16844 | ||
| </ | </ | ||
| + | * same data but with ''/'' | ||
| + | 2 11 / Migration rates between two Turkish frog populations | ||
| + | 3 Akcapinar (between Marmaris and Adana) | ||
| + | PB1058 | ||
| + | PB1059 | ||
| + | PB1060 | ||
| + | 2 Ezine (between Selcuk and Dardanelles) | ||
| + | PB16843 | ||
| + | PB16844 | ||
| + | |||
| === Microsatellite data === | === Microsatellite data === | ||
| Line 116: | Line 157: | ||
| * Genotypes | * Genotypes | ||
| * Each individual has two alleles | * Each individual has two alleles | ||
| - | * Alleles are coded as REPEAT NUMBERS | ||
| * homozygote individual: needs to be coded as e.g.: 6.6 (" | * homozygote individual: needs to be coded as e.g.: 6.6 (" | ||
| * missing data: "? | * missing data: "? | ||
| - | **example:** | + | |
| - | < | + | |
| 2 3 . Rana lessonae: Seeruecken versus Tal | 2 3 . Rana lessonae: Seeruecken versus Tal | ||
| - | 2 | + | 2 |
| 0 42.45 37.31 18.18 | 0 42.45 37.31 18.18 | ||
| 0 42.45 37.33 18.16 | 0 42.45 37.33 18.16 | ||
| Line 131: | Line 170: | ||
| 1 43.42 35.31 20.18 | 1 43.42 35.31 20.18 | ||
| </ | </ | ||
| + | * Alleles encoded as FRAGMENT LENGTH: | ||
| + | * extra line with repeat number, starts with ''# | ||
| + | 2 3 . Rana lessonae: Seeruecken versus Tal | ||
| + | #M 2 2 2 | ||
| + | 2 Riedtli near Guendelhart-Hoerhausen | ||
| + | 0 25.27 137.131 218.218 | ||
| + | 0 27.27 218.216 | ||
| + | 2 Tal near Steckborn | ||
| + | 1 23.25 135.? 218.218 | ||
| + | 1 23.23 135.131 220.218 | ||
| + | </ | ||
| === Sequence data === | === Sequence data === | ||
| Line 160: | Line 210: | ||
| **examples: | **examples: | ||
| + | * two populations with a single DNA-locus: < | ||
| + | 2 1 Make believe data set using simulated data (1 locus) | ||
| + | 50 | ||
| + | 3 Tallahassee (Mars) | ||
| + | Peter | ||
| + | Donald | ||
| + | Christian ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC | ||
| + | 3 St. Marks | ||
| + | Lucrezia | ||
| + | Isabel | ||
| + | Yasmine | ||
| + | </ | ||
| * not interleaved (2 population with 2 loci): < | * not interleaved (2 population with 2 loci): < | ||
| 2 2 Make believe data set using simulated data (2 loci) | 2 2 Make believe data set using simulated data (2 loci) | ||
| Line 176: | Line 238: | ||
| fuefLoc2 | fuefLoc2 | ||
| </ | </ | ||
| - | * interleaved (2 populations with 2 loci): < | + | * interleaved (2 populations with 2 loci) (not anymore supported by MIGRATE): < |
| 2 2 Make believe data set using simulated data (2 loci, interleaved) | 2 2 Make believe data set using simulated data (2 loci, interleaved) | ||
| 50 46 | 50 46 | ||
| Line 199: | Line 261: | ||
| GAGGGTCATGCGTCCCAGATGTG | GAGGGTCATGCGTCCCAGATGTG | ||
| GAGGGGCATGCGTCCCAGATGTG | GAGGGGCATGCGTCCCAGATGTG | ||
| + | </ | ||
| + | |||
| + | === SNP data === | ||
| + | * uses the same nucleotide nomenclature as the sequence data | ||
| + | * same format as sequence data | ||
| + | * linked SNP: more than one site on one line | ||
| + | * unlinked SNP: one site per line | ||
| + | * two formats: | ||
| + | * '' | ||
| + | N 2 2 Make believe data set using simulated data (2 population and 2 loci) | ||
| + | 1 4 | ||
| + | 3 3 pop1 | ||
| + | ind1 A | ||
| + | ind2 A | ||
| + | ind3 A | ||
| + | ind1 ACAC | ||
| + | ind2 ACAC | ||
| + | ind3 ACGC | ||
| + | 2 pop2 | ||
| + | ind4 C | ||
| + | ind5 C | ||
| + | ind4 TGGA | ||
| + | ind5 TCGA | ||
| + | </ | ||
| + | * '' | ||
| + | # using the HapMap data format, but does produce the same result (yet) as the dataset above | ||
| + | H 2 2 Make believe data set using simulated data (2 population and 2 loci) | ||
| + | 3 pop1 | ||
| + | 1 A 3 C 0 3 | ||
| + | 1000 A 3 T 0 3 | ||
| + | 1010 C 3 G 0 3 | ||
| + | 1011 A 2 G 1 3 | ||
| + | 1015 C 3 A 0 3 | ||
| + | 2 pop2 | ||
| + | 1 A 0 C 2 2 | ||
| + | 1000 A 0 T 2 2 | ||
| + | 1010 C 1 G 1 2 | ||
| + | 1011 A 0 G 2 2 | ||
| + | 1015 C 0 A 2 2 | ||
| </ | </ | ||
| ===== How to cite ===== | ===== How to cite ===== | ||
| - | Please cite the 1999 and the 2001 papers and one of the others:\\ | + | Beerli, P. (2009) How to use migrate or why are markov chain monte carlo programs dicult to use? In G. Bertorelle, M. W. Bruford, H. C. Haue, A. Rizzoli, and C. Vernesi, editors, Population |
| - | * Beerli, P. 1997-2004. Migrate: documentation and program, part of LAMARC. Version 2.0. Revised December 23, 2004. Distributed over the Internet, http:// | + | |
| - | * Beerli, P., and J. Felsenstein. 2001. PNAS. | + | |
| - | * Beerli, P., and J. Felsenstein. 1999. Maximum likelihood estimation of migration rates and population numbers of two populations using a coalescent approach. | + | |
| - | * Beerli, P. 1998. Estimation | + | |
migrate.1224678494.txt.gz · Last modified: 2008/10/22 14:28 by heidi