lamarc
Differences
This shows you the differences between two versions of the page.
| Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
| lamarc [2007/12/13 11:36] – heidi | lamarc [2008/07/22 13:31] (current) – external edit 127.0.0.1 | ||
|---|---|---|---|
| Line 3: | Line 3: | ||
| \\ | \\ | ||
| - | **[[http:// | + | **[[http:// |
| \\ | \\ | ||
| version 2.1.2b\\ | version 2.1.2b\\ | ||
| Lamarc is a program for doing **L**ikelihood **A**nalysis with **M**etropolis **A**lgorithm using **R**andom **C**oalescence. Lamarc estimates effective population sizes, population exponential growth rates, a recombination rate, and past migration rates for one to n populations assuming a migration matrix model with asymmetric migration rates and different subpopulation sizes. | Lamarc is a program for doing **L**ikelihood **A**nalysis with **M**etropolis **A**lgorithm using **R**andom **C**oalescence. Lamarc estimates effective population sizes, population exponential growth rates, a recombination rate, and past migration rates for one to n populations assuming a migration matrix model with asymmetric migration rates and different subpopulation sizes. | ||
| + | |||
| ===== Program information ===== | ===== Program information ===== | ||
| + | * written in C++ | ||
| * LINUX | * LINUX | ||
| * Mac OSX | * Mac OSX | ||
| Line 20: | Line 22: | ||
| * Microsatellites | * Microsatellites | ||
| * electrophoretic data | * electrophoretic data | ||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| + | |||
| ===== Input Files ===== | ===== Input Files ===== | ||
| + | === LAMARC File Converter: === | ||
| + | can convert [[PHYLIP]], RECOMBINE and [[MIGRATE]] files to a LAMARC [[XML presentation|XML file]] | ||
| + | |||
| + | === LAMARC XML file: === | ||
| + | * surrounded by < | ||
| + | |||
| + | **Data section: | ||
| + | contains the actual molecular data, and additional information used to interpret it | ||
| + | * enclosed in < | ||
| + | * < | ||
| + | * divides molecular data into " | ||
| + | * available genetic information that is closely linked on the same chromosome and has a known map | ||
| + | * Use multiple regions for data composed of several disconnected bits or bits whose connections are not known | ||
| + | * region' | ||
| + | * < | ||
| + | * specify a different relative effective population size for each < | ||
| + | * < | ||
| + | * Information about the relative position of segments | ||
| + | * < | ||
| + | * Each segment is indicated by this tag | ||
| + | * give information about the position of the segment itself and the positions of the markers within the segment | ||
| + | * < | ||
| + | * < | ||
| + | * < | ||
| + | * < | ||
| + | * < | ||
| + | * Within each region you can list various populations | ||
| + | * if you list < | ||
| + | * < | ||
| + | * < | ||
| + | * < | ||
| + | * < | ||
| + | * sequences themselves | ||
| + | * Each datablock must have an attribute indicating the type of data it contains (type=" | ||
| + | * Sequence data must be aligned and of the same length for all samples within a region | ||
| + | * " | ||
| + | * Upper- and lowercase nucleotide symbols are treated equivalently | ||
| + | * Deletions should be coded as unknown and will be treated as unknown | ||
| + | * Microsatellite data are coded as the number of repeats, with "?" | ||
| + | |||
| + | **examples: | ||
| + | * minimal DNA data block describing a single region, a single segment, a single population, and two individuals with a single haplotype each. Note that while the two blocks of data are differently formatted, they contain the same number of bases; this is required since all blocks corresponding to a single segment: <code xml> | ||
| + | < | ||
| + | <region name=" | ||
| + | < | ||
| + | < | ||
| + | < | ||
| + | < | ||
| + | CTTGTAACCTAATGGCTTCCGAGATGGACTAGTGAGCCGCTTTCTC | ||
| + | TACACCAACGCAGCACATGACGGTCTTACATGCGGAGCCCGCTCAA | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | < | ||
| + | < | ||
| + | < | ||
| + | CTTGTAACCTAATGGCTTCCGA | ||
| + | GATGGACTAGTGAGCCGCTTTCTC | ||
| + | TACACCAACGCAGCACATGACG | ||
| + | GTCTTACATGCGGAGCCCGCTCAA | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | * a microsatellite data block which also illustrates the use of multiple samples per individual. In this example, " | ||
| + | < | ||
| + | <region name=" | ||
| + | < | ||
| + | < | ||
| + | < | ||
| + | < | ||
| + | 7 8 14 7 9 21 | ||
| + | </ | ||
| + | </ | ||
| + | < | ||
| + | < | ||
| + | 7 9 14 7 9 21 | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | < | ||
| + | < | ||
| + | < | ||
| + | 7 9 14 7 10 23 | ||
| + | </ | ||
| + | </ | ||
| + | < | ||
| + | < | ||
| + | 8 9 13 7 ? 23 | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | </ | ||
| + | |||
| + | |||
| + | |||
| ===== How to cite ===== | ===== How to cite ===== | ||
lamarc.1197542210.txt.gz · Last modified: 2008/07/22 13:30 (external edit)