lamarc
Differences
This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revisionNext revisionBoth sides next revision | ||
lamarc [2007/12/13 11:32] – heidi | lamarc [2007/12/13 17:08] – heidi | ||
---|---|---|---|
Line 3: | Line 3: | ||
\\ | \\ | ||
- | **[[http:// | + | **[[http:// |
\\ | \\ | ||
version 2.1.2b\\ | version 2.1.2b\\ | ||
Lamarc is a program for doing **L**ikelihood **A**nalysis with **M**etropolis **A**lgorithm using **R**andom **C**oalescence. Lamarc estimates effective population sizes, population exponential growth rates, a recombination rate, and past migration rates for one to n populations assuming a migration matrix model with asymmetric migration rates and different subpopulation sizes. | Lamarc is a program for doing **L**ikelihood **A**nalysis with **M**etropolis **A**lgorithm using **R**andom **C**oalescence. Lamarc estimates effective population sizes, population exponential growth rates, a recombination rate, and past migration rates for one to n populations assuming a migration matrix model with asymmetric migration rates and different subpopulation sizes. | ||
+ | |||
===== Program information ===== | ===== Program information ===== | ||
+ | * written in C++ | ||
* LINUX | * LINUX | ||
* Mac OSX | * Mac OSX | ||
Line 20: | Line 22: | ||
* Microsatellites | * Microsatellites | ||
* electrophoretic data | * electrophoretic data | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
===== Input Files ===== | ===== Input Files ===== | ||
+ | === LAMARC File Converter: === | ||
+ | can convert [[PHYLIP]], RECOMBINE and [[MIGRATE]] files to a LAMARC [[XML presentation|XML file]] | ||
+ | |||
+ | === LAMARC XML file: === | ||
+ | * surrounded by < | ||
+ | |||
+ | **Data section: | ||
+ | contains the actual molecular data, and additional information used to interpret it | ||
+ | * enclosed in < | ||
+ | * < | ||
+ | * divides molecular data into " | ||
+ | * available genetic information that is closely linked on the same chromosome and has a known map | ||
+ | * Use multiple regions for data composed of several disconnected bits or bits whose connections are not known | ||
+ | * region' | ||
+ | * < | ||
+ | * specify a different relative effective population size for each < | ||
+ | * < | ||
+ | * Information about the relative position of segments | ||
+ | * < | ||
+ | * Each segment is indicated by this tag | ||
+ | * give information about the position of the segment itself and the positions of the markers within the segment | ||
+ | * < | ||
+ | * < | ||
+ | * < | ||
+ | * < | ||
+ | * < | ||
+ | * Within each region you can list various populations | ||
+ | * if you list < | ||
+ | * < | ||
+ | * < | ||
+ | * < | ||
+ | * < | ||
+ | * sequences themselves | ||
+ | * Each datablock must have an attribute indicating the type of data it contains (type=" | ||
+ | * Sequence data must be aligned and of the same length for all samples within a region | ||
+ | * " | ||
+ | * Upper- and lowercase nucleotide symbols are treated equivalently | ||
+ | * Deletions should be coded as unknown and will be treated as unknown | ||
+ | |||
+ | **example** (minimal DNA data block describing a single region, a single segment, a single population, and two individuals with a single haplotype each. Note that while the two blocks of data are differently formatted, they contain the same number of bases; this is required since all blocks corresponding to a single segment must contain the same number of markers. If your sequences for a given segment are of different lengths, they must be padded out with unknown-nucleotide codes) | ||
+ | <code xml> | ||
+ | < | ||
+ | <region name=" | ||
+ | < | ||
+ | < | ||
+ | < | ||
+ | < | ||
+ | CTTGTAACCTAATGGCTTCCGAGATGGACTAGTGAGCCGCTTTCTC | ||
+ | TACACCAACGCAGCACATGACGGTCTTACATGCGGAGCCCGCTCAA | ||
+ | </ | ||
+ | </ | ||
+ | </ | ||
+ | < | ||
+ | < | ||
+ | < | ||
+ | CTTGTAACCTAATGGCTTCCGA | ||
+ | GATGGACTAGTGAGCCGCTTTCTC | ||
+ | TACACCAACGCAGCACATGACG | ||
+ | GTCTTACATGCGGAGCCCGCTCAA | ||
+ | </ | ||
+ | </ | ||
+ | </ | ||
+ | </ | ||
+ | </ | ||
+ | </ | ||
+ | </ | ||
+ | |||
+ | |||
===== How to cite ===== | ===== How to cite ===== | ||
+ | Kuhner, M. K., 2006 " | ||
+ | |||
+ |
lamarc.txt · Last modified: 2008/07/22 13:31 by 127.0.0.1