Differences

This shows you the differences between two versions of the page.

--- mega [2008/05/19 17:00] – heidi
+++ mega [2011/07/07 11:50] (current) – heidi
@@ Line 8: / Line 8: @@
 \\
-Version 4 (May 1, 2008)\\
+Version 5 (Aril 24, 2011)\\
 MEGA is an integrated tool for conducting automatic and manual sequence alignment, inferring phylogenetic trees, mining web-based databases, estimating rates of molecular evolution, and testing evolutionary hypotheses.
@@ Line 15: / Line 16: @@
 ===== Program information =====
-  * Windows 95/98, NT, 2000, XP, and Vista (with at least 64 MB of RAM, 20 MB of available hard disk space)
+  * Windows XP, Vista, 7 (with at least 64 MB of RAM, 20 MB of available hard disk space)
   * MEGA also can be run on other operating systems for which Windows emulators are available:
     * Macintosh: Windows using VirtualPC
     * Sun Workstation: SoftWindows95
     * Linux: Windows using VMWare
@@ Line 27: / Line 29: @@
   * RNA
   * nucleotide
+  * distance
   * (protein sequences)
 ===== Input Files =====
   * ASCII-text files
   * extension: *.MEG
+  * Importing Data from Other Formats:
+    * CLUSTAL
+    * [[NEXUS]]
+    * [[PHYLIP]] (Interleaved/Noninterleaved)
+    * GCG
+    * [[FASTA]]
+    * PIR
+    * NBRF
+    * MSF
+    * IG
+    * Internet (NCBI) XML format
@@ Line 56: / Line 73: @@
     * written after the Title or the Description statement
     * contains one or more command statements
-    * A command statement contains a command and a valid setting keyword (''command=keyword format''
+    * A command statement contains a command and a valid setting keyword (''command=keyword format'')
 \\
-  * Comments: can be written anywhere in the data file and can span multiple lines. They must always be enclosed in square brackets ([and]) brackets and can be nested.
+  * Comments:
-  * keywords: can be written in any combination of lower- and upper-case letters
+    * anywhere in the data file
-  * Rules for Taxa Names: Distance matrices as well as sequence data may come from species, populations, or individuals. These evolutionary entities are designated as OTUs (Operational Taxonomic Units) or taxa. Each taxon must have an identification tag, i.e., a taxon Iabel according to the following conventions:
+    * can span multiple lines
-    * ‘#’ Sign: Every Iabel must be written on a new line, and a '#' sign must precede the label. There are no restrictions on the length of the Iabels in the data file. The labels are not required to be unique, although identical labels may result in ambiguities and should be avoided.
+    * enclosed in square brackets ([and])
-    * Characters: Taxa labels must start with alphanumeric characters (0-9, a-z, and A-Z) or a special character: ''-, + or .''. After the first character, taxa labels may contain the following additional special characters:''_, *, :, ( ), |, \, /''. For multiple word labels, an underscore can be used to represent a blank space.
+    * can be nested
+  * keywords:
+    * written in any combination of lower- and upper-case letters
+  * Taxa Names:
+    * ‘#’ Sign: Every Iabel must be written on a new line, and a '#' sign must precede the label
+    * no restrictions on the length of the Iabels
+    * not required to be unique (although identical labels may result in ambiguities and should be avoided)
+    * must start with alphanumeric characters (0-9, a-z, and A-Z) or a special character: ''-, + or .''
+    * After the first character, taxa labels may contain the following additional special characters:''_, *, :, ( ), |, \, /''
+    * For multiple word labels, an underscore can be used to represent a blank space
+\\
 ==== Sequence Input Data ====
@@ Line 86: / Line 117: @@
 | MatchChar | single character | Synonymous with the identical keyword | MatchChar = . |
 | Missing | single character | use question mark (?) to indicate missing data | Missing = ? |
+| CodeTable | A name | This instruction gives the name of the code table for the protein coding domains of the data | CodeTable = Standard |
   * **Defining Genes and Domains:**
@@ Line 96: / Line 129: @@
 | CodonStart | A number | specifies the site where the next 1st-codon position will be found in a protein-coding domain | CodonStart=2 |
-    * example: <code>
+  * **Defining Groups:**
+    * assign different taxa to groups in a sequence as well as to distance data files.
+    * the name of the group is written in a set of curly brackets ({}) following the taxa name. The group name can be attached to the taxa name using an underscore or just can be appended.
+    * there should be no spaces between the taxa name and group name
+  *  **Labelling Individual Sites:**
+    * The individual sites in nucleotide or amino acid data can be labeled to construct non-contiguous sets of sites.
+    * Each site can be associated with only one label
+    * A label can be a letter or a number.
+=== example ===
+<code>
 !Gene=FirstGene Domain=Exon1 Property=Coding;
 #Human_{Mammal} ATGGTTTCTAGTCAGGTCACCATGATAGGTCTCAAT
@@ Line 111: / Line 155: @@
 #Mouse ATCTGATCTCGTGTGCTGGTACGAATGATTTCTGCGTTCAACTGA
 #Chicken ATCTGCTCTCGAGTACTGCTACCAATGACTTCTGCGTACAACTGA
+!Label +++__-+++-a-+++-L-+++-k-+++123+++-_-+++---+++;
 </code>
+==== Distance Input Data ====
+  * in the lower-left or in the upper-right triangular matrix
+  * After writing the #mega,!Title,!Description, and !Format commands (some of which are optional), you then need to write all the taxa names (see below)
+  * Taxa names are followed by the distance matrix
+\\
+  * **Keywords for Format Statement:**
+^ Command ^ Setting ^ Remark ^ Example ^
+| DataType | Distance | Specifies that the distance data is in the file | DataType=distance |
+| NSeqs | integer | Number of sequences | NSeqs=85 |
+| NTaxa | integer | Same as NSeqs | NTaxa=85 |
+| DataFormat | Lowerleft, upperright | Specifies whether the data is in lower left triangular matrix or the upper right triangular matrix | DataFormat=lowerleft |
+  * **Defining Groups:**
+    * see above
 === example ===
+<code>
+#mega
+!Title: Concatenated Files;
+!Format DataType=Distance DataFormat=LowerLeft NTaxa=6;
+#Rodent
+#Primate
+#Lagomorpha
+#Artiodactyla
+#Carnivora
+#Perissodactyla
+.514
+.535 0.436
+.530 0.388 0.418
+.521 0.353 0.417 0.345
+.500 0.331 0.402 0.327 0.349
+</code>
 ===== How to cite =====
-  * When referring to MEGA in the main text of your publication, you may choose a format such as:\\
+Citation for MEGA 5:
-    Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 4 (Tamura, Dudley, Nei, and Kumar 2007).
+  * Tamura K, Peterson D, Peterson N, Stecher G, Nei M, and Kumar S (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution doi: 10.1093/molbev/msr121.
-  * When including a MEGA citation in the Literature Cited/Bibliography section, you may use the following:\\
-Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-1599. (Publication PDF at http://www.kumarlab.net/publications)
+\\
+Citation for MEGA 4:
+  * Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599.