fastq
Differences
This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
fastq [2011/09/05 15:18] – heidi | fastq [2011/09/19 16:19] (current) – heidi | ||
---|---|---|---|
Line 10: | Line 10: | ||
* text based | * text based | ||
* no standard file extension, but .fq, .fastq, and .txt are commonly used. | * no standard file extension, but .fq, .fastq, and .txt are commonly used. | ||
+ | |||
+ | |||
Line 19: | Line 21: | ||
* A FASTQ file normally uses four lines per sequence: | * A FASTQ file normally uses four lines per sequence: | ||
* Line 1: begins with a ' | * Line 1: begins with a ' | ||
- | * Line 2: is the raw sequence letters | + | * Line 2: is the raw sequence letters |
* Line 3: begins with a ' | * Line 3: begins with a ' | ||
- | * Line 4: encodes the quality values for the sequence in Line 2 and must contain the same number of symbols as letters in the sequence. | + | * Line 4: encodes the [[http:// |
* The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of " | * The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of " | ||
\\ | \\ | ||
- | ==== Example ==== | + | |
+ | |||
+ | |||
+ | ==== Example: ==== | ||
< | < | ||
@SEQ_ID | @SEQ_ID | ||
Line 34: | Line 39: | ||
</ | </ | ||
+ | * FASTQ files from the NCBI/EBI Sequence Read Archive often include a description: | ||
+ | < | ||
+ | @SRR001666.1 071112_SLXA-EAS1_s_7: | ||
+ | GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC | ||
+ | +SRR001666.1 071112_SLXA-EAS1_s_7: | ||
+ | IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC | ||
+ | </ | ||
\\ | \\ | ||
fastq.1315228722.txt.gz · Last modified: 2011/09/05 15:18 by heidi