fastq
Differences
This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
fastq [2011/09/05 15:10] – heidi | fastq [2011/09/19 16:19] (current) – heidi | ||
---|---|---|---|
Line 14: | Line 14: | ||
- | ===== Format ===== | ||
- | * A FASTQ file normally uses four lines per sequence. Line 1 begins with a ' | ||
- | ===== file format ===== | + | |
+ | |||
+ | ===== File format ===== | ||
+ | * A FASTQ file normally uses four lines per sequence: | ||
+ | * Line 1: begins with a ' | ||
+ | * Line 2: is the raw sequence letters (IUPAC ambiguity codes: ACTGNURYSWKMBDHV) | ||
+ | * Line 3: begins with a ' | ||
+ | * Line 4: encodes the [[http:// | ||
+ | * The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of " | ||
+ | |||
+ | \\ | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | ==== Example: ==== | ||
+ | < | ||
+ | @SEQ_ID | ||
+ | GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT | ||
+ | + | ||
+ | !'' | ||
+ | </ | ||
+ | |||
+ | * FASTQ files from the NCBI/EBI Sequence Read Archive often include a description: | ||
+ | < | ||
+ | @SRR001666.1 071112_SLXA-EAS1_s_7: | ||
+ | GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC | ||
+ | +SRR001666.1 071112_SLXA-EAS1_s_7: | ||
+ | IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC | ||
+ | </ | ||
\\ | \\ | ||
fastq.1315228208.txt.gz · Last modified: 2011/09/05 15:10 by heidi