baps
Differences
This shows you the differences between two versions of the page.
Both sides previous revisionPrevious revisionNext revision | Previous revision | ||
baps [2008/06/16 09:50] – heidi | baps [2013/02/20 13:24] (current) – heidi | ||
---|---|---|---|
Line 4: | Line 4: | ||
\\ | \\ | ||
- | Version 5.1\\ | + | Version 5.4 (29.04.2010)\\ |
A program for Bayesian inference of the genetic structure in a population. Assigns individuals to genetic clusters by either considering them as immigrants (mixture analysis) or ad descendants from immigrants (admixture analysis). | A program for Bayesian inference of the genetic structure in a population. Assigns individuals to genetic clusters by either considering them as immigrants (mixture analysis) or ad descendants from immigrants (admixture analysis). | ||
+ | |||
+ | |||
===== Program information ===== | ===== Program information ===== | ||
- | * Windows XP/2000/Vista | + | * Windows XP/Vista/7 (32-bit, 64-bit) |
- | * Mac OS X | + | * Mac Snow leopard |
- | * Linux | + | * Linux (32-bit) |
+ | |||
+ | |||
Line 17: | Line 22: | ||
===== Data type handled ===== | ===== Data type handled ===== | ||
* haploid/ | * haploid/ | ||
- | * SNP | + | |
+ | | ||
* AFLP | * AFLP | ||
* Microsatellite | * Microsatellite | ||
- | * multi-allelic markers | + | * Standard (multi-allelic markers) |
Line 72: | Line 78: | ||
\\ | \\ | ||
+ | |||
+ | |||
Line 82: | Line 90: | ||
* Last column contains the index of the group that is the origin of the alleles on the particular row (instead of specifying the individual) | * Last column contains the index of the group that is the origin of the alleles on the particular row (instead of specifying the individual) | ||
* the names of can be given in a seperate file | * the names of can be given in a seperate file | ||
+ | |||
+ | \\ | ||
+ | **example** (data from four distinct groups) | ||
+ | * data file:< | ||
+ | 5 | ||
+ | 7 | ||
+ | 5 | ||
+ | 3 | ||
+ | 2 | ||
+ | -999 5 3 | ||
+ | 5 | ||
+ | 2 | ||
+ | 3 | ||
+ | 2 | ||
+ | </ | ||
+ | |||
+ | * name file:< | ||
+ | American | ||
+ | European | ||
+ | African | ||
+ | Asian | ||
+ | </ | ||
=== GENEPOP format: === | === GENEPOP format: === | ||
Line 123: | Line 153: | ||
\\ | \\ | ||
+ | |||
+ | |||
+ | |||
+ | |||
==== Spatial clustering: ==== | ==== Spatial clustering: ==== | ||
- | Same as above, except for the coordinate values that need to be given in a separate file: | + | Same as the first two above, except for the coordinate values that need to be given in a separate file: |
- | * as many rows as there are individuals (spatial clustering of individuals) or groups (spatial clustering of groups) in the molecular data set. | + | * as many rows as there are individuals (spatial clustering of individuals |
* missing coordinate: two consecutive zeros | * missing coordinate: two consecutive zeros | ||
\\ | \\ | ||
**example: | **example: | ||
- | * Data flie: see first example | + | * Data file: see first example |
* Coordinate file: < | * Coordinate file: < | ||
172 88 | 172 88 | ||
Line 142: | Line 176: | ||
\\ | \\ | ||
+ | |||
==== Clustering of linked molecular data (sequence data): ==== | ==== Clustering of linked molecular data (sequence data): ==== | ||
=== MLST data format: === | === MLST data format: === | ||
+ | * for prokaryotik organism | ||
* first column: identifier where the numbering should go linearly from 1 to number of isolates (unique for each) | * first column: identifier where the numbering should go linearly from 1 to number of isolates (unique for each) | ||
* second column: unique ID label for each isolate (for printing results). The header could either be “Isolate” or “Strain” | * second column: unique ID label for each isolate (for printing results). The header could either be “Isolate” or “Strain” | ||
* third column (optional): provides a species or similar group name for the isolates | * third column (optional): provides a species or similar group name for the isolates | ||
* remaining columns: genes for which there are aligned sequences available | * remaining columns: genes for which there are aligned sequences available | ||
+ | * if header is given: columns can be in different order | ||
**example: | **example: | ||
Line 171: | Line 208: | ||
\\ | \\ | ||
- | === BASP data format: === | + | === BAPS data format: === |
* haploid marker data (single data row per individual) | * haploid marker data (single data row per individual) | ||
* diploid marker data (two rows per individual) | * diploid marker data (two rows per individual) | ||
Line 177: | Line 214: | ||
\\ | \\ | ||
- | * numeric data input format or a direct sequence based format: | + | numeric data input format or a direct sequence based format: |
- | * numeric format: replacing each of A,C,G,T with a unique integer and missing values with a negative integer (-999). Individual Index after the sequence separated by a space | + | * **numeric format:** |
- | * sequence format: Individual Index after the sequence separated by a space | + | * replacing each of A,C,G,T with a unique integer and missing values with a negative integer (-999) |
+ | * Individual Index after the sequence separated by a space | ||
+ | * example: a single data row for individual 110 with sequence AACCG-T could lool like this: < | ||
+ | 65 65 67 67 71 -999 84 110 | ||
+ | </ | ||
- | **example** (diploid): < | + | |
+ | * Individual Index after the sequence separated by a space | ||
+ | * example | ||
ATTTGCCTACGTAGCCAATT 1 | ATTTGCCTACGTAGCCAATT 1 | ||
TTACCGACCTTAAAAACCTT 1 | TTACCGACCTTAAAAACCTT 1 | ||
Line 188: | Line 231: | ||
</ | </ | ||
- | | + | \\ |
+ | | ||
* number of rows equals the number of genes | * number of rows equals the number of genes | ||
* at each row, the integers refer to those columns of the data matrix that correspond to the specific gene | * at each row, the integers refer to those columns of the data matrix that correspond to the specific gene | ||
+ | * Additional zeros are used to fill the rows to have an equal number of colummns | ||
**example** (“linkage map”: 3 genes the first corresponding to the columns 1-10 in the data matrix and so on. Additional zeros result in a matrix having an equal number of columns for each row): < | **example** (“linkage map”: 3 genes the first corresponding to the columns 1-10 in the data matrix and so on. Additional zeros result in a matrix having an equal number of columns for each row): < | ||
Line 234: | Line 279: | ||
===== How to cite ===== | ===== How to cite ===== | ||
+ | Tang J, Hanage WP, Fraser C, Corander J. (2009). Identifying currents in the gene pool for bacterial populations using an integrative approach. PLoS Computational Biology, 5(8): e1000455. | ||
+ | \\ | ||
Corander, J., Waldmann, P., Marttinen, P. and Sillanpää, | Corander, J., Waldmann, P., Marttinen, P. and Sillanpää, | ||
baps.1213602602.txt.gz · Last modified: 2008/07/22 13:30 (external edit)