Masterarbeit, Heidi Lischer

User Tools

Site Tools

Trace: • baps • geneland • tau
baps

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revisionPrevious revision
Next revision		Previous revision
baps [2008/06/16 09:50] – heidibaps [2013/02/20 13:24] (current) – heidi
Line 4: Line 4:
  
 \\ \\
-Version 5.1\\+Version 5.4 (29.04.2010)\\
 A program for Bayesian inference of the genetic structure in a population. Assigns individuals to genetic clusters by either considering them as immigrants (mixture analysis) or ad descendants from immigrants (admixture analysis). A program for Bayesian inference of the genetic structure in a population. Assigns individuals to genetic clusters by either considering them as immigrants (mixture analysis) or ad descendants from immigrants (admixture analysis).
 +
 +
  
  
 ===== Program information ===== ===== Program information =====
-  * Windows XP/2000/Vista +  * Windows XP/Vista/7 (32-bit, 64-bit) 
-  * Mac OS X +  * Mac Snow leopard OS X (64-bit) 
-  * Linux+  * Linux (32-bit) 
 + 
 + 
  
  
Line 17: Line 22:
 ===== Data type handled ===== ===== Data type handled =====
   * haploid/diploid/(tetraploid)   * haploid/diploid/(tetraploid)
-  * SNP+  * DNA 
 +  * SNP (sequence/numeric)
   * AFLP   * AFLP
   * Microsatellite   * Microsatellite
-  * multi-allelic markers+  * Standard (multi-allelic markers)
  
  
Line 72: Line 78:
  
 \\ \\
 +
 +
  
  
Line 82: Line 90:
   * Last column contains the index of the group that is the origin of the alleles on the particular row (instead of specifying the individual)   * Last column contains the index of the group that is the origin of the alleles on the particular row (instead of specifying the individual)
   * the names of can be given in a seperate file   * the names of can be given in a seperate file
 +
 +\\
 +**example** (data from four distinct groups)
 +  * data file:<code>
 +5     2     1
 +7     2     1
 +5     8     1
 +3     9     2
 +2     5     2
 +-999  5     3
 +5     -999  4
 +2     3     4
 +3     8     4
 +2     5     4
 +</code>
 +
 +  * name file:<code>
 +American
 +European
 +African
 +Asian
 +</code>
  
 === GENEPOP format: === === GENEPOP format: ===
Line 123: Line 153:
  
 \\ \\
 +
 +
 +
 +
  
  
 ==== Spatial clustering: ==== ==== Spatial clustering: ====
-Same as above, except for the coordinate values that need to be given in a separate file: +Same as the first two above, except for the coordinate values that need to be given in a separate file: 
-  * as many rows as there are individuals (spatial clustering of individuals) or groups (spatial clustering of groups) in the molecular data set.+  * as many rows as there are individuals (spatial clustering of individuals -> sampling coordinates of each individual) or groups (spatial clustering of groups -> sampling coordinates of each group) in the molecular data set.
   * missing coordinate: two consecutive zeros   * missing coordinate: two consecutive zeros
  
 \\ \\
 **example:** **example:**
-  * Data flie: see first example+  * Data file: see first example
   * Coordinate file: <code>   * Coordinate file: <code>
 172  88 172  88
Line 142: Line 176:
  
 \\ \\
 +
  
  
 ==== Clustering of linked molecular data (sequence data): ==== ==== Clustering of linked molecular data (sequence data): ====
 === MLST data format: === === MLST data format: ===
 +  * for prokaryotik organism
   * first column: identifier where the numbering should go linearly from 1 to number of isolates (unique for each)   * first column: identifier where the numbering should go linearly from 1 to number of isolates (unique for each)
   * second column: unique ID label for each isolate (for printing results). The header could either be “Isolate” or “Strain”   * second column: unique ID label for each isolate (for printing results). The header could either be “Isolate” or “Strain”
   * third column (optional): provides a species or similar group name for the isolates   * third column (optional): provides a species or similar group name for the isolates
   * remaining columns: genes for which there are aligned sequences available   * remaining columns: genes for which there are aligned sequences available
 +  * if header is given: columns can be in different order
  
 **example:** <code> **example:** <code>
Line 171: Line 208:
  
 \\ \\
-=== BASP data format: ===+=== BAPS data format: ===
   * haploid marker data (single data row per individual)   * haploid marker data (single data row per individual)
   * diploid marker data (two rows per individual)   * diploid marker data (two rows per individual)
Line 177: Line 214:
  
 \\ \\
-  * numeric data input format or a direct sequence based format: +numeric data input format or a direct sequence based format: 
-    * numeric format: replacing each of A,C,G,T with a unique integer and missing values with a negative integer (-999). Individual Index after the sequence separated by a space +  * **numeric format:**  
-    * sequence format: Individual Index after the sequence separated by a space+    * replacing each of A,C,G,T with a unique integer and missing values with a negative integer (-999) 
 +    * Individual Index after the sequence separated by a space 
 +    * example: a single data row for individual 110 with sequence AACCG-T could lool like this: <code> 
 +65 65 67 67 71 -999 84 110 
 +</code>
  
-**example** (diploid): <code>+  * **sequence format:**  
 +    * Individual Index after the sequence separated by a space 
 +    * example (diploid): <code>
 ATTTGCCTACGTAGCCAATT 1 ATTTGCCTACGTAGCCAATT 1
 TTACCGACCTTAAAAACCTT 1 TTACCGACCTTAAAAACCTT 1
Line 188: Line 231:
 </code> </code>
  
-  * separate file of gene boundaries:+\\ 
 +  * In contrast to the MLST format you need under the BAPS format to concatenate the sequences from all considered genes into a single one and tell the program about the gene boundaries in a separate file. Separate file of gene boundaries:
     * number of rows equals the number of genes     * number of rows equals the number of genes
     * at each row, the integers refer to those columns of the data matrix that correspond to the specific gene     * at each row, the integers refer to those columns of the data matrix that correspond to the specific gene
 +    * Additional zeros are used to fill the rows to have an equal number of colummns
  
 **example** (“linkage map”: 3 genes the first corresponding to the columns 1-10 in the data matrix and so on. Additional zeros result in a matrix having an equal number of columns for each row): <code> **example** (“linkage map”: 3 genes the first corresponding to the columns 1-10 in the data matrix and so on. Additional zeros result in a matrix having an equal number of columns for each row): <code>
Line 234: Line 279:
  
 ===== How to cite ===== ===== How to cite =====
 +Tang J, Hanage WP, Fraser C, Corander J. (2009). Identifying currents in the gene pool for bacterial populations using an integrative approach. PLoS Computational Biology, 5(8): e1000455.
 +\\
 Corander, J., Waldmann, P., Marttinen, P. and Sillanpää, M.J. (2004).  BAPS 2: enhanced possibilities for the analysis of genetic population structure, Bioinformatics,  20, 2363-2369. Corander, J., Waldmann, P., Marttinen, P. and Sillanpää, M.J. (2004).  BAPS 2: enhanced possibilities for the analysis of genetic population structure, Bioinformatics,  20, 2363-2369.
  
baps.1213602602.txt.gz · Last modified: 2008/07/22 13:30 (external edit)