MEGA

MEGA
documentation

Version 5 (Aril 24, 2011)
MEGA is an integrated tool for conducting automatic and manual sequence alignment, inferring phylogenetic trees, mining web-based databases, estimating rates of molecular evolution, and testing evolutionary hypotheses.

• Windows XP, Vista, 7 (with at least 64 MB of RAM, 20 MB of available hard disk space)
• MEGA also can be run on other operating systems for which Windows emulators are available:
  • Macintosh: Windows using VirtualPC
  • Sun Workstation: SoftWindows95
  • Linux: Windows using VMWare

• DNA
• RNA
• nucleotide
• distance
• (protein sequences)

• ASCII-text files
• extension: *.MEG
• Importing Data from Other Formats:
  • CLUSTAL
  • NEXUS
  • PHYLIP (Interleaved/Noninterleaved)
  • GCG
  • FASTA
  • PIR
  • NBRF
  • MSF
  • IG
  • Internet (NCBI) XML format

• first line: must contain the keyword #MEGA
• second line: data file may contain a succinct description of the data (called Title). The Title statement is written according to a set of rules:
  • always begins with !Title and ends with a semicolon
  • not occupy more than one line of text
  • must not contain a semicolon inside the statement
  • example:

    #mega
    !Title This is an example title;

• third line: Description statement: more descriptive multi-line account of the data.
  • always begins with !Description and ends with a semicolon
  • may occupy multiple lines
  • must not contain a semicolon inside the statement
  • example:

    #mega
    !Title This is an example title;
    !Description This is detailed information the data file;

• Format statement: which includes information on the type of data present in the file and some of its attributes.
  • written after the Title or the Description statement
  • contains one or more command statements
  • A command statement contains a command and a valid setting keyword (command=keyword format)

• Comments:
  • anywhere in the data file
  • can span multiple lines
  • enclosed in square brackets ([and])
  • can be nested
• keywords:
  • written in any combination of lower- and upper-case letters
• Taxa Names:
  • ‘#’ Sign: Every Iabel must be written on a new line, and a '#' sign must precede the label
  • no restrictions on the length of the Iabels
  • not required to be unique (although identical labels may result in ambiguities and should be avoided)
  • must start with alphanumeric characters (0-9, a-z, and A-Z) or a special character: -, + or .
  • After the first character, taxa labels may contain the following additional special characters:_, *, :, ( ), |, \, /
  • For multiple word labels, an underscore can be used to represent a blank space

• must consist of two or more sequences of equal length
• sequences must be aligned
• written in IUPAC single-letter codes
• Sequences can be written in any combination of upper- and lower-case letters
• spaces and tabs are ignored
• generally used special symbols : period (.) → identical sites, dash (-) → alignment gaps, question mark (?) → missing data

• Keywords for Format Statement:

• Defining Genes and Domains:
  • attributes of different sites (and groups of sites, termed domains) are specified within the data “on the spot” rather than in an attributes block before or after the actual data.

• Defining Groups:
  • assign different taxa to groups in a sequence as well as to distance data files.
  • the name of the group is written in a set of curly brackets ({}) following the taxa name. The group name can be attached to the taxa name using an underscore or just can be appended.
  • there should be no spaces between the taxa name and group name

• Labelling Individual Sites:
  • The individual sites in nucleotide or amino acid data can be labeled to construct non-contiguous sets of sites.
  • Each site can be associated with only one label
  • A label can be a letter or a number.

!Gene=FirstGene Domain=Exon1 Property=Coding;
#Human_{Mammal} ATGGTTTCTAGTCAGGTCACCATGATAGGTCTCAAT
#Mouse_{Mammal} ATGGTTTCTAGTCAGGTCACCATGATAGGTCCCAAT
#Chicken_{Aves} ATGGTTTCTAGTCAGCTCACCATGATAGGTCTCAAT

!Gene=SecondGene Domain=Intron Property=Noncoding;
#Human ATTCCCAGGGAATTCCCGGGGGGTTTAAGGCCCCTTTAAAGAAAGAT
#Mouse GTAGCGCGCGTCGTCAGAGCTCCCAAGGGTAGCAGTCACAGAAAGAT
#Chicken GTAAAAAAAAAAGTCAGAGCTCCCCCCAATATATATCACAGAAAGAT

!Gene=ThirdGene Domain=Exon2 Property=Coding;
#Human ATCTGCTCTCGAGTACTGATACAAATGACTTCTGCGTACAACTGA
#Mouse ATCTGATCTCGTGTGCTGGTACGAATGATTTCTGCGTTCAACTGA
#Chicken ATCTGCTCTCGAGTACTGCTACCAATGACTTCTGCGTACAACTGA
!Label +++__-+++-a-+++-L-+++-k-+++123+++-_-+++---+++;

• in the lower-left or in the upper-right triangular matrix
• After writing the #mega,!Title,!Description, and !Format commands (some of which are optional), you then need to write all the taxa names (see below)
• Taxa names are followed by the distance matrix

• Keywords for Format Statement:

• Defining Groups:
  • see above

#mega
!Title: Concatenated Files;
!Format DataType=Distance DataFormat=LowerLeft NTaxa=6;

#Rodent
#Primate
#Lagomorpha
#Artiodactyla
#Carnivora
#Perissodactyla
      
0.514       
0.535 0.436       
0.530 0.388 0.418       
0.521 0.353 0.417 0.345       
0.500 0.331 0.402 0.327 0.349

Citation for MEGA 5:

• Tamura K, Peterson D, Peterson N, Stecher G, Nei M, and Kumar S (2011) MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution doi: 10.1093/molbev/msr121.

Citation for MEGA 4:

• Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599.