FASTQ

wikipedia: FASTQ format
http://nar.oxfordjournals.org/content/early/2009/12/16/nar.gkp1137.full

FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are encoded with a single ASCII character for brevity. It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA sequence and its quality data, but has recently become the de facto standard for storing the output of high throughput sequencing instruments such as the Illumina Genome Analyzer.

• text based
• no standard file extension, but .fq, .fastq, and .txt are commonly used.

• A FASTQ file normally uses four lines per sequence:
  • Line 1: begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line)
  • Line 2: is the raw sequence letters (IUPAC ambiguity codes: ACTGNURYSWKMBDHV)
  • Line 3: begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again.
  • Line 4: encodes the quality values for the sequence in Line 2 and must contain the same number of symbols as letters in the sequence.
• The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of “@” and “+” as markers (these characters can also occur in the quality string).

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

• FASTQ files from the NCBI/EBI Sequence Read Archive often include a description:

@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC